Before hearing two explanations of how these fish came to be, it’s important to understand what this kind of fish is. For better familiarity, the Angler Fish is the fish that was shown in the movie Nemo! On a serious note, the Angler Fish has several odd, but interesting characteristics. Some live in shallow waters, but for the most part they live usually one mile below the surface. The ones that live in shallow waters are called Pelagic and they have different sizes (although the male is about 3 times smaller than the female) and colors in order to camouflage themselves with their surroundings. Those that live in complete ocean darkness are called Benthic and they (the females) collect bioluminescent bacteria on their esca, as shown in the picture, to attract their prey. Additionally, their stomach can expand to twice its original size. These fish live in waters that have the pressure equivalent to two tons, which is compared to two elephants crushing a human from every side. Relating back to the size of these fish, the small males attach to the females with their hook-like teeth so they can become one. The tissue on the female Angler Fish dissolves a bit so the males bloodstream can connect to that of the females. All of the male organs are lost except the testes so the female can use when she is ready to mate. A female can carry up to 6 males on her body at the time, all of which absorb her nutrients. Another interesting fact is that the male does not have a dorsal spine, which benefits them when they attach to a female. Also, the males have enlarged nostrils that helps them detect the chemical that females release.

Both Charles Darwin/A.R. Wallace and Jean-Baptiste Lamarck would agree that this type of fish, like others, has evolved from millions and millions of years ago. This fish evolved in response to moving to a different environment in order to survive, however, the traits that evolved vary different in perspectives by Darwin/Wallace and Lamarck.

Darwin and Wallace believe in natural selection, and this animal has a lot of traits that would support their argument on the adaptations they have developed. For example, the scarcity of food in the deep sea caused many adaptations in the Angler Fish. An obvious one is the esca that carries bioluminescent light because without it, it would not be very probable that the fish could attract any prey, much less capture it and eat it. Following the idea of capturing and eating prey, the large jaw and expansion of the stomach allow the fish to easily get the prey it desires. Darwin and Wallace would say that the fish that had the larger jaw and stomach survived, had offspring, and passed this down generations. Lamarck would argue that the fish continued stretching their jaws and stomachs and then passed that gene down to their offspring. The males attaching to the females evolved once again because of the scarcity of the food, now the males act as parasites onto the females. This also caused males to evolve without a backbone, so it would be easier for them to get rid of organs once attached to the females. Darwin and Wallace would argue that males began absorbing nutrients from females while mating and were able to survive, thus passing down this gene of attachment to the females. Lamarck would argue that the males began attaching to females because they knew that is what they needed in order to survive. Lastly, another key characteristics is the enlargement of nostrils of the male. Darwin and Wallace would say that those males with slightly bigger nostrils better detected the chemicals released by females, therefore they survived and passed this gene down to their offspring. Lamarck would say that the males continued stretching their noses to smell better and were eventually able to enlarge their noses and then pass this down generations.

            BLAST, also known as basic local alignment search tool, compares DNA and/or RNA sequences. There are different types of BLAST algorithms because all contain different types of sequences that allow the identification of genomes and proteins (Porterfield, 2014). This is done not only in a fairly quick manner, but it’s also accurate. Additionally, the database in a BLAST algorithm is continually growing with the help of scientists that are always adding sequences to it. My DNA sequence was “TACTTTTTATAGTACCGACCTAACGTTGTTTGGTTGTCACTTTTC”, and the proteins it coded for were “Methionine, Lysine, Asparagine, Isoleucine, Methionine, Alanine, Glycine, Leucine, Glutamine, Glutamine, Threonine, Asparagine, Serine, Glutamine, and Lysine. The protein the BLAST sequencing said I had was dystrophin, partial (homo sapiens), and the disease this protein is involved in is Duchenne Muscular Dystrophy (DMD). Since the protein dystrophin helps keep muscle cells intact, in this disease there is an absence of such disease.

Porterfield, A. (2014, September 24). How Does BLAST Work? Retrieved from https://bitesizebio.com/21223/how-does-blast-work/

In the 1960’s, Lynn Margulis was able to greatly advance the work that constitute this theory of the origins of mitochondria in animals and chloroplasts in plants. Although like several other theories in biology, hers was not accepted immediately at first, scientists now see and appreciate what she discovered. Put into simpler terms, the endosymbiotic theory states the origins of eukaryotic cells such as the ones stated previously. Among the many different organelles found in eukaryotic cells, mitochondria is one of them. Proteobacteria is where mitochondria is considered to have originated due to endosymbiosis. Endosymbiosis is simply when one organism lives inside another and they mutually benefit each other. Chloroplasts was also able to originate due to endosymbiosis, however since it’s found in plants it would be from cyanobacteria (Fossil Museum, N.d.).

Both these organelles were once free-living prokaryotic cells. However because of endosymbiosis, through one way or another, they ended up inside another cell. Instead of one cell dying, they thrived by living together and now they can’t survive without one another because they both provide needed benefits (Warring, 2018). Now, why is it believed that that these organelles were once free-living organisms? Well, that is supported for several reasons. To begin with, the genes found in organelles are very similar to those of modern day prokaryotes. Also, both divide and replicate in similar ways and have similar membranes as well (Editors, 2018).

Although the exact time when this occurred is debated a lot, the fact that it happened holds true due to all the evidence that proves the theory. It can get complicated though because this process isn’t a one time thing. It can happen several times and to trace that seems nearly impossible. Which is why, trying to do so does not get exact results therefore making it a challenging topic to fully understand. Something that is also debated a lot when referring to this topic is from what eukaryotic domain these prokaryotes originated from (Fossil Museum, 2018). Whatever the case, the endosymbiotic theory is important in biology to further understand how it is that life originated and evolved.

Editors. (2018). Endosymbiotic Theory Definition. Retrieved from https://biologydictionary.net/endosymbiotic-theory/

Fossil Museum. (N.d.). Endosymbiosis – The Appearence of the Eukaryotes. Retrieved from http://www.fossilmuseum.net/Evolution/Endosymbiosis.htm

Warring, S. (2018). Endosymbiotic Theory. Retrieved from https://askabiologist.asu.edu/explore/cells-living-in-cells

I remember in elementary school going on a field trip that stressed how bad High Fructose Corn Syrup was. I didn’t really understand much other than the idea that “that kind of sugar is bad kids”. I don’t really remember anything useful at the field trip other than the main catch. Besides, I was really small anyways so I didn’t have much knowledge of food that was “good” for you and food that was “bad” for you.

The idea of high fructose corn syrup (HFCS) was proposed around the 1950’s by Richard Marshall and Earl Cooi. It wasn’t until the late 1960’s that it began to be used in the food industry. Not only was HFCS used because of it’s sweetness and chemical stability but compared to sucrose, HFCS was much easier to use in the industries because of how cheap it was. The issue arose because of the domestic turmoil the United States was facing during the time. There was fuel shortages and rationing, and not enough cane sugar was being imported into the United States. Real sugar couldn’t be afforded so alternatives had to be made (Zorn, 2014). Additionally, in 1977 the United States placed not only production quotas but a tariff on imported sugar, yet it subsidizes corn production because it pays growers. This made HFCS much more popular and it began to be used more often.

HFCS is made from cornstarch so during this time a lot of corn was being grown. The cornstarch is mixed with water and an enzyme. Since cornstarch contains long chains of glucose, the enzyme breaks them down to shorter ones. Then, another enzyme is produced in order to turn the shorter chains into glucose molecules (corn syrup). In order to get HFCS another enzyme has to be added to turn some glucose molecules into fructose (Diabetes Health Editor, 2011). On a molecular level, HFCS and sugar are very similar. The composition of sucrose is a 50:50 ratio with glucose and fructose. With HFCS, the ratio is either a bit higher or a bit lower, depending on the kind of HFCS. A difference, however, is that in HFCS the molecules of glucose and fructose “float” freely while in sugar they are bound together.

Everything in excess is bad, and sugar is no exception. A significant difference, however, is the fact that HFCS is processed a bit differently than regular sucrose. It’s processed in a way that contributes more rapidly to obesity due to how it is metabolized as fat in the body. Also, HFCS is in liquid form so the effect it has on the body is significantly magnified. However, whether Americans have an intake of sucrose or HFCS, they decide what and how much to put in their bodies. American’s bad diets and bad habits of consuming HFCS or natural sugar in excess is what causes all the health problems many are facing. I personally believe that society has gotten to the point of blaming whatever they can for the problems we now have such as obesity. HFCS may slightly contribute to it, but only because we humans let it. If each person would be more aware of how much of a certain thing they’re consuming the WHAT wouldn’t be as much of a problem.

Citations

Zorn, M. (2014). Who Invented High Fructose Corn Syrup. Retrieved from http://visionlaunch.com/who-invented-high-fructose-corn-syrup/

Editor, D. H. (2011). How High Fructose Corn Syrup (HFCS) Is Made. Retrieved from https://www.diabeteshealth.com/how-high-fructose-corn-syrup-hfcs-is-made/

I, Samantha Alanis, am raised under a household where much is expected. My parents are not constantly asking about my grades, when I have tests coming up, or anything similar. My parents have taught both my older brother and I to become independent human beings. At a very young age I was indeed bothered by the delegation of tasks that was given to me, but now I am thankful for such things. I have learned that life is not nearly as easy as it’s shown in movies. Life is hard, life is complicated, but you have to keep moving forward.

With this thought in mind, comes the thought of my senior year. A year where I am sure life will get very complicated. However, I look forward to it all. Even the bad times. I know those moments will only teach me lessons I’ll need for the future and it’s better to go through it now, than much later. I know there will be nights with no sleep, and that is never any fun but hopefully this year I can start doing my assignments much before they’re due. As of where I am to apply to college, I am not entirely sure. I look forward to talking to various teachers to hear what advice they have to give me. I’m thinking about getting my associates in nursing (much cheaper), start working, and simply get my bachelors while I am already working since it will be required starting 2020 anyways. If that doesn’t work though UNC, NCCU, and UNCG all sound like good choices to me.

I’d have to say some of my best aspects include determination, dependableness, and intelligence. I have both of my parents to thank for the several wonderful aspects they helped me acquire throughout my young life. My dad used to work a lot and my mom didn’t know English very well when I was born but when I began school they made sure I became educated. That has continued throughout my years in school, thankfully, and that’s because of them. My determination to complete a task or a goal I have in mind has always been something that people will comment to me about. If there is something that has to be done, I need to finish it and I need to finish it well. This also intertwines with dependableness I believe because especially in group-work if a task is to be done, my group members can count on me to do it. That is the one case where I do not procrastinate, although I do on my own assignments. I wish I wouldn’t but I always have, and I do wish I could stop. On the bright side I do finish my work, just with a little more unnecessary stress.

If there were no limits I would travel and travel and travel. I love visiting new places and really appreciating how different yet how beautiful every place is. I love helping people, which is why I want to become a nurse, so I believe traveling where the need is greater is how I’d want to help this world. I don’t propose curing everything in society but at least I can provide comfort each and every person desires. I would want to go to Spain to get lost. The views and the food simply look amazing. Since I speak Spanish I wouldn’t mind getting lost, but I would love to just walk and explore everything there is.

I typically don’t read too much, but last year in APUSH we read “Destiny of the Republic” about James Garfield and I can say it did have a major influence on me. With how advanced technology is nowadays it’s so easy to forget what people had to go through to get us where we’re at today. Every once in a while it’s good to stop and appreciate everything we have. People lost their lives in order for us to live how we do, and the least we can do is show our appreciation. I would have to say I am most passionate about not taking things for granted. Both my parents grew up in poverty and they made a life together from the bottom. They always took advantage of what they could and with that they were able to get where they are today. Today they are in a more than a happy place not only economically but in every other way as well, and I too hope to live that way.

Thanks for joining me!

Good company in a journey makes the way seem shorter. — Izaak Walton