BLAST, also known as basic local alignment search tool, compares DNA and/or RNA sequences. There are different types of BLAST algorithms because all contain different types of sequences that allow the identification of genomes and proteins (Porterfield, 2014). This is done not only in a fairly quick manner, but it’s also accurate. Additionally, the database in a BLAST algorithm is continually growing with the help of scientists that are always adding sequences to it. My DNA sequence was “TACTTTTTATAGTACCGACCTAACGTTGTTTGGTTGTCACTTTTC”, and the proteins it coded for were “Methionine, Lysine, Asparagine, Isoleucine, Methionine, Alanine, Glycine, Leucine, Glutamine, Glutamine, Threonine, Asparagine, Serine, Glutamine, and Lysine. The protein the BLAST sequencing said I had was dystrophin, partial (homo sapiens), and the disease this protein is involved in is Duchenne Muscular Dystrophy (DMD). Since the protein dystrophin helps keep muscle cells intact, in this disease there is an absence of such disease.
Porterfield, A. (2014, September 24). How Does BLAST Work? Retrieved from https://bitesizebio.com/21223/how-does-blast-work/